A. Selecting a target sequence

The genomic target sequence should fulfill the following requirements:

  • 20-nt long
  • followed by a 3-nt PAM sequence: NGG
  • begin with a G to optimize U6-driven transcription 

Cas9 nuclease cuts 3-nt upstream of the PAM site (cleavage site indicated by red arrowhead). The 12 nt upstrearm of the PAM site (underlined) are often referred to as the seed sequence and are the most critical determinants of cleavage specificity.

You can use the flyCRISPR Optimal Target Finder tool to identify highly specific target sites in the Drosophila genome.

Due to the frequency of naturally occurring SNPs between fly strains, it is a good idea to sequence the region you intend to target in the fly strain you plan to inject into prior to cloning any gRNAs. Even a single SNP in the targeting sequence can drastically lower cleavage efficiency.

B. Site-directed mutagenesis cloning strategy

This protocol is based off of the Q5 (NEB) site-directed mutagenesis protocol. A similar protocol has been used by Deepti Trivedi Vyas and can be found at the flyCRISPR Discussion Group.

1. Design PCR primers based on the following template:

forward primer: 5’ – G (19 nt) GTTTTAGAGCTAGAAATAGCAAG – 3’

reverse primer: 5’ – GAAGTATTGAGGAAAACATACCTATATAAATG – 3’

  • The forward primer in unique to each gRNA and contains a 5’ G for efficient U6-driven expression followed by the target site sequence.
  • The 19-nt sequence is the EXACT same sequence as the genomic target sequence. Do not include the 3-nt NGG PAM sequence.
  • The reverse primer is common to all reactions.

2. Amplify pU6-2-BbsI-gRNA

1.0 μL pU6-BbsI-gRNA (1 pg–1 ng)
2.5 μL 10 µM Forward Primer
2.5 μL 10 µM Reverse Primer
10 μL 5X Q5 Reaction Buffer
1.0 μL 10 mM dNTPs
0.5 µL Q5 High-Fidelity DNA Polymerase
Nuclease-Free Water to 50 µL

Thermocycling Conditions:

Initial melting – 98˚C for 30 seconds
35 cycles – 98˚C for 10 seconds, 62˚C for 30 seconds, 72˚C for 2 minutes
Final extension – 72˚C for 10 minutes

3. Use agarose gel electrophoresis to purify the gRNA PCR product

4. Ligate the PCR product

Assemble the following reaction:

50 ng of PCR Product from above
2 µL of 10X T4 DNA ligase buffer
1 µL T4 Polynucleotide Kinase
1 µL DpnI
Nuclease-Free Water to 20 uL total

Incubate at 37 ˚C for 30 min

Add PEG4000 to 5% final w/v and 1 µL of T4 DNA ligase. Mix thoroughly.

Incubate on bench for 10 min at room temperature and then place on ice.

Transform 4 µL of the reaction and select and screen colonies. Confirm inserts by sequencing with either T7 or T3 oligos.

C. Alternative restriction enzyme cloning strategy

Targeting gRNAs are easily cloned by annealed oligos into the pU6-BbsI-chiRNA plasmid via the BbsI restriction sites:

1. Design oligos based on the following template:

sense oligo:    5’ –   CTTCG (19 nt)        – 3’
antisense oligo:  3’ –         C (19 nt) CAAA   – 5’

example:

  • The overhang sequences 5’ – CTTC – 3’ (sense oligo) and 3’ – CAAA – 5’ (antisense oligo) are complementary to overhangs generated by BbsI digestion.
  • The G in the sense oligo corresponds to the first nt of the gRNA and is necessary for efficient U6-driven expression. This G is the first nt in the 20-nt targeting sequence.
  • The sense oligo19-nt sequence is the EXACT same sequence as the genomic target sequence. Do not include the 3-nt NGG PAM sequence.
  • Red arrowhead indicates Cas9 cut site.

Oligos should be ordered 5’ phosphorylated or phosphorylated using T4 PNK.

2. Anneal oligos

Using oligos phosophorylated by the manufacturer.
Dilute oligos at 100 μM in H­2O and set up the following reaction:

1μL oligo 1
1μL oligo 2
1μL 10x T4 ligation buffer
7μL water

Run the following thermocycler program:
95˚C for 5 min, then ramp to 25˚C at a rate of -0.1˚C/sec.

When using PNK to phosphorylate the oligos.
Dilute oligos at 100 μM in H­2O and set up the following reaction:

1μL oligo 1
1μL oligo 2
1μL 10x T4 ligation buffer
1μL T4 Polynucleotide Kinase (NEB)
6μL water

Run the following thermocycler program:
37˚C for 30 min, 95˚C for 5 min, then ramp to 25˚C at a rate of -0.1˚C/sec. 

3. Cut the pU6-BbsI-gRNA plasmid with BbsI enzyme and de-phosphorylate.

Digest 1μg of pU6-BbsI-chiRNA the BbsI (NEB) following the manufacturer’s protocol. Half way through the digestion add 1μL of Calf Intestinal Alkaline Phosphatase (NEB).

Gel purify the digested product to aid in removal of undigested vector.

4. Ligate the annealed oligos with cut pU6-BbsI-gRNA and transform E. coli.

XμL BbsI digested pU6-BbsI-gRNA (50ng)
1μL annealed oligo insert
1μL 10x T4 ligation buffer
1μL T4 DNA ligase (NEB)
H­2O to 10μL

Incubate at 25˚C for one hour then transform. Confirm inserts by sequencing with either T7 or T3 oligos.